Table 5

Primers used in this study.

Plasmid

Gene

Primer Sequence (5'-3')


pRJ1

mgsA

F: GGGAAA

    GGTACC
ATGGCACTTATAATGAATAGTAAAAAAAAGATAGC

R: GGGAAA

    GCATGC
TTAAAAATTGTCTTTTCTAATTTTTTGGTAATAAT

pRJ2

mgsA

F: GGGAAA

    GGTACC
ATGAAAATTGCTTTGATCGCGCATG

R: GGGAAA

    GCATGC
TTATACATTCGGCTCTTCTCCCCGA

pRJ3

mgsA

F: GGGAAA

    GGTACC
ATGAATATAGCATTAGTAGCACATGACCAAATGAA

R: GGGAAA

    GCATGC
TTAAATACGTTGACTTTTGCTTTTTCTAACTTCTC

pRJ4

mgsA

F: GGGAAA

    GGTACC
ATGGAACTGACGACTCGCAC

R: GGGAAA

    GCATGC
TTACTTCAGACGGTCCGCGA

pRJ5

mgsA

F: GGGAAA

    GGTACC
ATGCCCATGAAGGCCCTGGC

R: GGGAAA

    GCATGC
CTATTGGGGGGTTCCCTTGC

pRJ6

mgsA

F: GGGAAA

    GGTACC
ATGTGGAATGAAAATATGGAACTGACAACACGTAC

R: GGGAAA

    GCATGC
TTATTTCAGGCGCTCGGCAA

pRJ7

mgsA

F: GGGAAA

    TGTACA
ATGATCGGTATCAGTTTCACCC

R: GGGAAA

    GCATGC
TTATCCTCGGCCGGCCAGGTA

pRJ8

mgsA

F: GGGAAA

    GGTACC
ATGACTCGCCCCCGCATCGCGTTGAT

R: GGGAAA

    TCTAGA
TCAGCTGGCCGCCGCTTCGT

pRJ9

gldA

F: GGGAAA

    GCATGC
AGGAGATATACCATGGACCGCATTATTCAATCACCGG

R: GGGAAA

    TCTAGA
TTATTCCCACTCTTGCAGGAAACGC

pRJ10

ydjG

F: GGGAAA

    GGTACC
ATGAAAAAGATACCTTTAGGCACAACGG

R: GGGAAA

    TCTAGA
TTAACGCTCCAGGGCCTCTGCCATTTCC

pRJ11

ydjG

budC

mgsA

F: GGGAAA

    GGTACC
ATGAAAAAGATACCTTTAGGCACAACGG

R: GGGAAA

    GTCGAC
TTAACGCTCCAGGGCCTCTGCCATT

F: GGGAAA

    GTCGAC
AGGAGATATACCATGAAAAAAGTCGCACTTGTTACCGG

R: GGGAAA

    CTGCAG
TTAGTTAAACACCATCCCGCCGTCG

F: GGGAAA

    CTGCAG
AGGAGATATACCATGAAAATTGCTTTGATCGCGCATGAC

R: GGGAAA

    TCTAGA
TTATACATTCGGCTCTTCTCCCCGA

pYY93

ppdABC

F: GGGAAA

    CGTACG
ATGAGATCGAAAAGATTTGAAGCACTGGCGAAACG

R: GGGAAA

    AAGCTT
TTAATCGTCGCCTTTGAGTTTTTTACGCTCGACG

pYY109

budC

F: GGGAAA

    GGATCC
GAAAAAAGTCGCACTTGTTACCGGCG

R: GGGAAA

    GTCGAC
TTAGTTAAACACCATCCCGCCGTCG

pYY134

gldABC

F: GGGCCC

    GGTACC
ATGAAAAGATCAAAACGATTTGCAGTACTGGCCCA

R: GGGCCC

    AAGCTT
TTAGCTTCCTTTACGCAGCTTATGCCGCTGCTGAT

pYY167

dhaB12

F: GGGAAA

    GGTACC
ATGATCAGCAAAGGGTTCAGCACCCAG

R: GGGAAA

    AAGCTT
TTATTCCGCGCCTATAGTACACGGAATGCCCATAA


Underlined nucleotides represent restriction sites. Italicized nucleotides represent ribosome binding sites inserted in the primer.

Jain and Yan Microbial Cell Factories 2011 10:97   doi:10.1186/1475-2859-10-97

Open Data