Open Access Highly Accessed Research

Achieving efficient protein expression in Trichoderma reesei by using strong constitutive promoters

Junxin Li, Juan Wang, Shaowen Wang, Miao Xing, Shaowen Yu and Gang Liu*

Author Affiliations

College of Life Science, Shenzhen Key Laboratory of Microbial Genetic Engineering, Shenzhen University, Shenzhen, 518060, China

For all author emails, please log on.

Microbial Cell Factories 2012, 11:84 doi:10.1186/1475-2859-11-84


The electronic version of this article is the complete one and can be found online at: http://www.microbialcellfactories.com/content/11/1/84


Received:9 February 2012
Accepted:7 June 2012
Published:18 June 2012

© 2012 Li et al.; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Backgrounds

The fungus Trichoderma reesei is an important workhorse for expression of homologous or heterologous genes, and the inducible cbh1 promoter is generally used. However, constitutive expression is more preferable in some cases than inducible expression that leads to production of unwanted cellulase components. In this work, constitutive promoters of T. reesei were screened and successfully used for high level homologous expression of xylanase II.

Results

The transcriptional profiles of 13 key genes that participate in glucose metabolism in T. reesei were analyzed by quantitative real-time reverse-transcription polymerase chain reaction (RT-qPCR). The results indicated that the mRNA levels of pdc (encoding pyruvate decarboxylase) and eno (encoding enolase) genes were much higher than other genes under high glucose conditions. Recombinant T. reesei strains that homologously expressed xylanase II were constructed by using the promoters of the pdc and eno genes, and they respectively produced 9266 IU/ml and 8866 IU/ml of xylanase activities in the cultivation supernatant in a medium with high glucose concentration. The productivities of xylanase II were 1.61 g/L (with the pdc promoter) and 1.52 g/L (with the eno promoter), approximately accounted for 83% and 82% of the total protein secreted by T. reesei, respectively.

Conclusions

This work demonstrates the screening of constitutive promoters by using RT-qPCR in T. reesei, and has obtained the highest expression of recombinant xylanase II to date by using these promoters.

Keywords:
Trichoderma Reesei; Xylanase; Pyruvate decarboxylase; Enolase; Quantitative real-time PCR

Backgrounds

Trichoderma reesei is an attractive host for the expression of homologous and heterologous proteins because of its ability to secrete large amounts of hydrolytic enzymes [1-3]. It has been reported that highly productive T. reesei strains are able to produce and secrete up to 100 g/L of protein in optimal culture conditions, and the main ingredients are cellulases [4]. Of the secreted proteins in T. reesei, cellobiohydrolase I (CBHI) dominates, accounting for approximately 50%-60% of the total secreted proteins [5,6]. Since CBHI is encoded by single copy of cbh1, the cbh1 promoter is considered to be strong and has been used to produce various kinds of homologous or heterologous proteins [1,7-10].

The cbh1 promoter is an inducible promoter. It is induced by several kinds of saccharides, such as cellulose, sophorose, lactose, etc., and regulated by catabolic repression. When the cbh1 promoter is used for protein expression, an inducer (or inducers) has to be added to trigger the expression of the target genes. However, such inducers also promote the expression of cellulase components, such as cellobiohydrolases, endo-β-glucanases, xylanases, etc. [11-13]. Unselective expression of cellulase components leads to contamination of target proteins with an excess of irrelevant proteins, and increases the difficulty for protein purification. Furthermore, extracellular proteases, which are deleterious to the yield of protein expression, might be produced simultaneously with cellulase induction [4].

In contrast, recombinant protein production mediated by constitutive promoters in T. reesei is more selective. Constitutive promoters drive gene expression without inducers. Unlike inducible promoters which are repressed by glucose, most of constitutive promoters are active in a glucose-rich medium. As cellulases whose formation is repressed with high concentration of glucose account for 90%-95% of the T. reesei extracellular proteins [14], application of constitutive promoters can effectively reduce the accumulation of irrelevant proteins. Furthermore, in the case of constitutive expression, synthesis of extracellular proteases, which may digest the expressed products, is also inhibited, at least partly, by high glucose concentration [15,16]. Several constitutive promoters of T. reesei, such as the tef1 and pki promoters, and the promoter of an unidentified cDNA1, have been employed for recombinant protein production [15,17]. However, the efficiency of these promoters is relatively low. Efforts have been made to convert the cbh1 promoter into a constitutive promoter by mutating the sequences therein that are responsible for catabolic repression, and the modified cbh1 promoters that are constitutively active have been obtained. However, the protein expression level is about ten times lower in the presence of glucose than those obtained on a sorbitol-sophorose medium with the wild type cbh1 promoter [18].

This study describes the screening of strong constitutive promoters and homologous over-expression of xylanase II (XYNII) with these promoters in T. reesei QM9414. The T. reesei strain is cultivated in a glucose containing medium, and the transcriptional profile of 13 key genes related to glucose metabolism is analyzed by using quantitative real-time reverse-transcription polymerase chain reaction (RT-qPCR). The promoters and the terminators of two genes (pdc, encoding pyruvate decarboxylase; and eno, encoding enolase) with high expression level are used to construct expression cassettes that consist of XYNII, which are then transformed into the parental strain T. reesei QM9414. The recombinant T. reesei strains are cultivated in a modified Mandels medium, and extremely high yields of recombinant XYNII are obtained. The highest xylanase activity in the culture supernatant of the recombinant strain is 9266 IU/ml, which is the highest recombinant expression of XYNII achieved to date.

Results

Evaluation of constitutive promoter activities in different glucose concentrations

The genes that are responsible for glucose utilization are usually regarded as housekeeping genes, and their expression is driven by constitutive promoters. However, as previously described, the expression of these genes in T. reesei might still be affected by glucose concentration [19]. 13 critical genes that participate in glucose metabolism according to Chambergo et al.[19] were selected and their transcriptional profiles were quantitatively analyzed by using RT-qPCR. These genes include those encoding glyceraldehyde-3-phosphate dehydrogenase (gpd), pyruvate decarboxylase (pdc), enolase (eno), alcohol dehydrogenase (adh), triose phosphate isomerase (tpi), aldolase (fba), pyruvate kinase (pyk), citrate synthase (cit), α-ketoglutarate dehydrogenase (kdh), aldehyde dehydrogenase I (ald1), aldehyde dehydrogenase II (ald2), pyruvate dehydrogenase (pda), and glucokinase (glk), which participate in glycolysis and the tricarboxylic acid cycle. Samples were taken at 24 h, 44 h and 84 h of cultivation, when the residue concentration of glucose was 15.6 g/L (about 85 mM), 10.3 g/L (about 56 mM) and 0 g/L, respectively. The results indicated that the expression levels of two genes (pdc and eno) decreased in accordance with glucose exhaustion, the expression levels of six genes (pyk, ald2, cit, glk, ald1 and fba) increased with glucose exhaustion, while those of four genes (gpd, tpi, pda and kdh) were relatively stable (Figure 1). The expression level of the adh gene changed irregularly during glucose exhaustion, possibly due to other factors that influenced the transcription of this gene. To construct a constitutive expression system, the promoters that are active at high glucose concentration might be preferable, for recombinant protein production in rapidly growing cells is more active. The formation of proteases is also somewhat repressed in high-level glucose cultivation [15,16]. Therefore, according to an analysis of the relationship between the transcriptional efficiency of the 13 genes and glucose concentration, the promoters of pdcenogpd, tpi, pda and kdh appear to be proper candidates for the construction of a constitutive expression system.

thumbnailFigure 1. (A) The time course of glucose consumption inT. reeseiculture. (B)The transcriptional profiles of the 13 key genes related with glucose metabolism during cultivation.Error bars represent standard deviations. The mRNA level of the genes at a 0 mM glucose concentration is assigned 1. The relative expression levels of the genes at 85 mM and 56 mM glucose concentrations are shown in white dotted bars and grey dotted bars, respectively.

Selection of strong constitutive promoters

The relative expression levels of the genes in T. reesei QM9414 that grows at different glucose concentrations are shown in Figure 2. The expression levels of pdcenogpd are obviously higher than the other genes, especially when T. reesei grows at high glucose concentrations. For instance, the mRNA level of pdc is approximately 1,373 times higher than that of ald2 when the glucose concentration is 85 mM. The expression level of the gpd gene is the highest among the 13 genes at low glucose concentrations. The mRNA levels of gpd are 39 times higher (at a glucose concentration of 56 mM) and 22 times higher (at a glucose concentration of 0 mM) than those of pyk, whose promoter has been applied in the construction of a constructive expression system and proven to be relatively weak [17]. Since the expression levels of pdc and eno increased with glucose concentration, their promoters might be stronger than that of gpd at higher glucose concentrations. Actually, at a glucose concentration of 85 mM, the expression level of pdc had already surpassed gpd, and eno had the tendency to do so at higher glucose concentrations. Therefore, the promoters of pdc and eno were selected for the construction of constitutive expression cassettes, and the gpd promoter was selected as the reference. The promoter and the terminator regions of these genes were acquired from the genome sequence of T. reesei (http://genome.jgi-psf.org/Trire2/Trire2.home.html webcite). Ppdc, the promoter of pdc, is located from 106110 bp to 107643 bp in scaffold 8; Tpdc, the terminator of pdc, is located from 103156 bp to 104185 bp in scaffold 8. Peno, the promoter of eno, is located from 102421 bp to 103910 bp in scaffold 4; Teno, the terminator of eno, is located from 99879 bp to 100865 bp in scaffold 4. Pgpd, the promoter of gpd, is located from 1561323 bp to 1562759 bp in scaffold 1; and Tgpd, the terminator of gpd, is located from 1564087 bp to 1564995 bp in scaffold 1.

thumbnailFigure 2. Comparison of the expression levels of the 13 genes related with glucose metabolism.Error bars represent standard deviations. A, B and C indicate the relative expression levels of the genes at 84 h, 44 h, and 24 h of cultivation, when the glucose concentration in the medium was 0 mM, 56 mM and 85 mM, respectively. The mRNA level of ald1 is assigned 1. White bars represent the relative expression levels of the 12 genes.

Application of strong promoters in homologous xyn2 expression

To evaluate the transcriptional activities of the promoters screened by RT-qPCR, xyn2 was selected as a reporter, since it is convenient and standardized to perform xylanase activity assays. This gene encodes XYNII, a small xylanase of T. reesei that has been expressed in various hosts [20-22]. The xyn2 expression cassettes, Ppdc-xyn2-Tpdc, Peno-xyn2-Teno, and Pgpd-xyn2-Tgpd, were respectively mixed with pAN7-1, and the mixtures were used to transform T. reesei QM9414. About 25% of the transformants that were resistant to hygromycin B contained the co-transformed expression cassette. The transformants that exhibited the highest xylanase productivity for each expression cassette were designated as T. reesei pxyn2, T. reesei exyn2, and T. reesei gxyn2, respectively. The expression cassettes in the transformants were PCR amplified, with the genomic DNA as the template (Figure 3), and the PCR amplified products were sequenced and proven to be correctly constructed. Southern blot analysis showed that all of these transformants had a single-copy insert of the expression cassette. The expression cassettes might be inserted into the genome of T. reesei randomly, for the endogenous pdceno and gpd cassettes remained intact in the transformants (Figure 3).

thumbnailFigure 3. Agarose gel electrophoresis analysis of PCR amplified XYNII expression cassettes from the recombinant strains.Lanes: M the DNA molecular weight marker, Lanes 1, 3, 5 the PCR amplified Peno-xyn2-Teno expression cassette (3282 bp), Ppdc-xyn2-Tpdc expression cassette (3369 bp), and Pgpd-xyn2-Tgpd expression cassette (3151 bp); Lanes 2, 4, 6 the native expression cassettes for eno (4032 bp), pdc (4488 bp), and gpd (3673 bp).

Then, T. reesei pxyn2, T. reesei exyn2, and T. reesei gxyn2, which respectively expressed xyn2 under the control of promoters Ppdc, Peno, Pgpd, were cultivated for recombinant XYNII production. The parent strain, T. reesei QM9414, was selected as the control. The activity of xylanase in the cultivation supernatant of the three transformants all reached the peak at 168 h of incubation (Figure 4). T. reesei pxyn2 exhibited the highest productivity of recombinant XYNII, with 9266 IU/ml of xylanase activity in the culture supernatant, while T. reesei exyn2 produced 8866 IU/ml of xylanase activity, which is slightly lower than that of T. reesei pxyn2. T. reesei gxyn2, in which the transcription of recombinant xyn2 was controlled by Pgpd, produced 686 IU/ml of xylanase activity, approximately 7% of that of T. reesei pxyn2. Hardly any production of XYNII could be detected in T. reesei QM9414.

thumbnailFigure 4. Time course of recombinant xylanase II production by the recombinant strains. □: T. reesei pxyn2, ○: T. reesei exyn2, ▵: T. reesei gxyn2. Error bars represent standard deviations.

The proteins in the culture supernatant of the recombinant strains were analyzed by SDS-PAGE (Figure 5). Recombinant XYNII secreted by T. reesei pxyn2 and T. reesei exyn2 was the most abundant protein in the supernatant, accounting for approximately 83% and 82% of the total protein as estimated by the densitometry method. The amount of total protein in the supernatant of T. reesei pxyn2 and T. reesei exyn2 was 1.94 g/L and 1.85 g/L, respectively, as determined by the Bradford method. Therefore, the recombinant XYNII secreted by T. reesei pxyn2 and T. reesei exyn2 strains was 1.6 g/L and 1.5 g/L, respectively. As for the recombinant strain T. reesei gxyn2, the secreted recombinant XYNII was still the most prominent protein, but far less abundant than that of the other two recombinant strains. In agreement with the results of the xylanase activity assay, there was no visible protein band that corresponded to XYNII in the SDS-PAGE gel of the parent strain T. reesei QM9414. The results showed that the strong constitutive promoters screened by RT-qPCR have great potential in conducting recombinant gene expression in T. reesei.

thumbnailFigure 5. SDS-PAGE analysis of expressed xylanase II in the culture supernatant of the recombinant strains.Lanes: M low molecular marker, 1 the parent strain T. reesei QM9414, 2 strain T. reesei gxyn2, 3 strain T. reesei exyn2, 4 strain T. reesei pxyn2. Equal amounts of protein (3 μl supernatant) are applied in each lane.

Discussion

The strong cbh1 promoter has been used frequently for heterologous or homologous protein expression in T. reesei. However, this promoter needs induction and is at least partly regulated by catabolite repression. Several constitutive promoters, such as the tef1 and pyk promoters, have been used to drive recombinant protein production in T. reesei, but their transcriptional activities are fairly low when compared with the cbh1 promoter [15,17]. In general, there is still a lack of constitutive promoters for T. reesei, either for heterologous protein production or for genetic manipulation. In yeast, there are a number of research works dealing with promoter finding and optimization, and many effective promoters have been characterized, such as the GAP promoter in Pichia pastoris and the TEF1 promoter in Saccharomyces cerevisiae[23-25]. This report has analyzed the transcriptional efficiency of the promoters of 13 key genes that participate in glucose metabolism through RT-qPCR. The results indicate that the pdc promoter (Ppdc), the eno promoter (Peno), and the gpd promoter (Pgpd) are more active in glucose containing medium. Glucose concentration influences the transcriptional efficiency of the promoters in different ways, i.e., the transcriptional efficiency of Ppdc and Peno dramatically increases at high glucose concentrations, while that of Pgpd only increases slightly.

To verify the actual ability of these promoters in triggering recombinant protein production, expression cassettes of xyn2 with the promoters were constructed and transformed into T. reesei QM9414, respectively. The recombinant strains, T. reesei pxyn2, T. reesei exyn2 and T. reesei gxyn2 for the pdc, eno and gpd promoters, respectively, were cultivated in a modified Mandels medium with a glucose concentration of 7%. The T. reesei pxyn2 strain presented the highest ability to produce recombinant protein, while the T. reesei gxyn2 strain had a lower ability. This result is consistent with the data of the expression levels of the corresponding genes initiated by these promoters as analyzed through RT-qPCR. Although the mRNA level of pdc is lower than gpd at low glucose concentrations, it increases faster with glucose concentration, and at 85 mM of glucose concentration, the mRNA level of pdc is 2.1 times higher than the gpd. The mRNA level of eno also shows the trend to increase faster with glucose concentration, and it is reasonable that the productivity of recombinant xylanase of T. reesei exyn2 is 8866 IU/ml, which is also much higher than T. reesei gxyn2. As indicated in Figure 2, the gpd promoter is more efficient than the eno promoter when the glucose concentration is 85 mM. However, glucose concentration in the medium for recombinant xylanase production is 7%, which is approximately 388 mM and much higher than 85 mM. Therefore, there is enough room for the efficiency of the eno promoter to increase and surpass that of the gpd.

Aside from cellulase, T. reesei is also regarded as an important producer of xylanase. Induced by arabinose-rich plant hydrolysates and lactose in fed-batch cultures, the mutant strain T. reesei Rut C-30 produces up to 1350 IU/ml of xylanase [26]. However, under induced conditions, T. reesei produces a large amount of cellulase aside from xylanase, and cellulase is problematic for the application of xylanase in some industrial processes, such as biobleaching [27]. To resolve this problem, many researchers have utilized a heterologous expression system to produce xylanase from recombinant fungi or bacteria. For example, a xylanase gene (xyn6) originated from the thermophilic fungus Humicola grisea has been cloned and expressed in T. reesei by Nevalainen et al.[28,29], and a productivity of 0.5-1 g/L recombinant xylanase is achieved. In the present study, we screened strong constitutive promoters of T. reesei through RT-qPCR, and developed a novel approach to produce cellulase-free xylanase by using the promoters of the pdceno and gpd genes. The T. reesei pxyn2 and T. reesei exyn2 recombinant strains, in which the pdc and the eno promoters were respectively used to conduct the xyn2 gene expression, produced 9266 IU/ml and 8866 IU/ml of activity in a modified Mandels medium. Moreover, under constitutive production with high glucose concentrations, the recombinant strains produce little other proteins as revealed by the SDS-PAGE image (Figure 5), and only a trace of cellulase activity is detected, with 0.3 IU/ml of CMCase activity and 0.03 FPIU/ml of filter paper activity. To date, the highest native production of obtained in T. reesei is 1800 IU/ml with a fed-batch cultivation process [26], and the highest heterologous production of xylanase obtained is 3676 IU/ml with a fed-batch cultivation of Pichia pastoris expressing A. niger xylB[30]. We used strong constitutive promoters in the xylanase production in T. reesei, and obtained recombinant productivity of 9266 IU/ml for the pdc promoter and 8866 IU/ml for the eno promoter in batch cultivation, which are much higher than the best native and heterologous xylanase production levels to date. Thus, this study has reported the most efficient process for xylanase production among all native and heterologous production processes.

Conclusions

The expression efficiencies of the genes related with glucose metabolism have been analyzed through RT-qPCR. The results reveal that the pdc promoter and the eno promoter are highly active, especially in medium with high concentration of glucose. These promoters have great potential in driving recombinant gene expression in T. reesei. Two recombinant strains, T. reesei pxyn2 and T. reesei exyn2, that respectively contained the xyn2 expression cassettes constructed with the promoters of pdc and eno, exhibit high productivity of recombinant XYNII in medium with high concentration of glucose. In addition, recombinant XYNII is the dominant protein in the culture supernatant, and the cellulase activity produced is negligible. The approach of producing recombinant proteins in T. reesei with the promoters high functional on glucose could be widely applied in industrial enzyme production.

Materials and methods

Strains, plasmids, and cultivation conditions

Escherichia coli (E. coli) Top10F’ (Invitrogen, USA) was used for plasmid construction and maintenance. T. reesei QM9414 (ATCC 26921) was used as a parental strain throughout the study. The E. coli strain was cultivated in LB medium, in which ampicillin (100 μg/ml, Invitrogen) was supplemented when necessary. The T. reesei strain was maintained on potato dextrose agar (PDA), and for liquid cultivation, it was grown in Mandels medium that contained an appropriate concentration of glucose [31]. The recombinant T. reesei strains were selected on PDA agar supplemented with hygromycin B (100 μg/ml), and for recombinant xylanase production, the strains were cultivated in modified Mandels medium supplemented with 7% glucose, 5% soybean powder, and 1% peptone. The E. coli and T. reesei strains were routinely cultured at 37°C and 28°C, respectively. Plasmid pUC19 was used for the construction of xyn2 expression cassettes. Plasmid pAN7-1 which contained the hygromycin B resistant cassette was used as an assisting plasmid for the transformation of T. reesei[32].

RNA extraction and cDNA synthesis

About 107T. reesei spores collected from a PDA plate grown for 5 days were inoculated into a 2-liter flask that contained 400 ml of Mandels medium with glucose at a final concentration of 1.8% (100 mM). They were then grown at 28°C and 250 r/min. Samples were taken at 24, 44 and 84 hours. Mycelia were harvested by centrifuge, frozen in liquid nitrogen and stored at −80°C. The glucose concentration in the samples was measured by using the 3, 5-dinitrosalicylic acid (DNS) method [33]. The total RNA of the samples was extracted by using a Universal Plant Total RNA Extraction Kit (BioTeke Corporation, China). To remove the genomic DNA, the RNA preparations were treated with DNase I (Fermentas, Canada). The quantity and quality of the extracted RNA were assessed on a GeneQuant 1300 spectrophotometer (Biochrom Ltd., England) and by agrose gel electrophoresis. The synthesis of the complementary DNA (cDNA) from 1.0 μg of the total RNA per reaction (20 μl) was carried out by using a PrimeScript reagent kit (TaKaRa).

Quantitative real-time PCR

Quantitative real-time PCRs (RT-qPCRs) were performed in an ABI Prim 7300 System (Applied Biosystems, USA). Each reaction mixture contained 2 μl of template (1:60 dilution of the reverse transcription (RT) reaction product), 10 μl of SYBR Premix Ex Taq 2× (TaKaRa), 300 nmol/L of forward and reverse primers (Table 1), and nuclease-free water with a final volume of 20 μl. The PCR protocol consisted of 30 s of initial denaturation at 95°C, followed by 40 cycles of 5 s at 95°C and 31 s at 60°C. A melting curve was performed after each run to check the PCR product specificity. All PCRs were carried out in triplicate on a plate. Data obtained by using the ABI Prim 7300 Sequence Detection System were analyzed as described in the Applied Biosystems User Bulletin #2. The expression levels of the genes in the glucose metabolism were normalized with an endogenous control, sar1, as previously described by Steiger et al.[34]. The means ± standard deviations of replicates are shown in the figures.

Table 1. Sequences of primers used in cDNA synthesis

Construction of Ppdc-xyn-Tpdc expression cassette

The promoter of the pdc gene (Ppdc, 1,534 bp upstream fragment starting from the start coden of pdc), the xyn2 gene, and the terminator of the pdc gene (Tpdc, 1,030 bp downstream fragment starting from the stop codon of pdc) were PCR amplified by using the genomic DNA of T. reesei QM9414 as the template. The primers Ppdc-F and Ppdc-R were used for amplification of Ppdc, and a HindIII restriction site was added to the 5’-end of the amplified product. The primers xyn-p-F and xyn-p-R were used for amplification of xyn2 (GenBank accession number: U24191.1), and a PstI site was added to the 3’-end. The signal peptide coding sequence was included in the amplified xyn2. The primers Tpdc-F and Tpdc-R were used for Tpdc amplification, and PstI and XbaI sites were added to the 5’ and 3’ ends, respectively. The amplified Ppdc and xyn2 fragments were fused by overlapping extension PCR through the use of primers Ppdc-F and xyn-p-R, and the resulting fusion fragment was inserted into pUC19 by using the restriction sites HindIII and PstI, which generated recombinant plasmid pUC19-Ppdc-xyn2. Finally, the Tpdc fragment was inserted into plasmid pUC19-Ppdc-xyn2 by using PstI and XbaI sites, which generated plasmid pUC19-Ppdc-xyn2-Tpdc. This plasmid was used for the transformation of T. reesei QM9414 and the recombinant expression of XYNII. The primers are listed in Table 2. The restriction enzymes, DNA polymerase and T4 DNA ligase were purchased from TaKaRa.

Table 2. Sequences of primers used for construction of expression cassettes

Construction of Peno-xyn-Teno expression cassette

This procedure is similar to the construction of the Ppdc-xyn-Tpdc expression cassette. The eno promoter (Peno, 1,490 upstream fragment starting from the start codon of the eno gene), xyn2 gene, and eno terminator (Teno, 987 bp downstream fragment starting from the stop codon of the eno gene) were PCR amplified from T. reesei QM9414 genomic DNA with the primers listed in Table 2. Restriction sites were added to the fragments as needed. The amplified Peno and xyn2 fragments were fused by overlapping extension PCR through the use of primers Peno-F and xyn-e-R, and the resulting fusion fragment was inserted into pUC19. Finally, Teno was inserted into the plasmid, which generated the expression plasmid pUC19-Peno-xyn2-Teno.

Construction of Pgpd-xyn-Tgpd expression cassette

For construction of the Pgpd-xyn-Tgpd expression cassette, the gpd promoter (Pgpd, 1,437 bp upstream fragment starting from the start codon of the gpd gene), xyn2 gene, and gpd terminator (Tgpd, 805 bp downstream fragment starting from the stop codon of the gpd gene) were PCR amplified from T. reesei QM9414 genomic DNA with the primers listed in Table 2. Restriction sites were added to the fragments as needed. The amplified Pgpd and xyn2 fragments were fused by overlapping extension PCR through the use of primers Pgpd-F and xyn-g-R, and the resulting fusion fragment was inserted into pUC19. Finally, Tgpd was inserted into the plasmid, which generated the expression plasmid pUC19-Pgpd-xyn2-Tgpd.

Protoplast transformation of T. Reesei

Protoplast transformation of T. reesei was performed by using the polyethylene glycol method as described in Punt et al.[32]. Lysing enzymes from Trichoderma harzianum (Sigma-Aldrich) were used in the T. reesei protoplast preparation. For the transformation, the expression cassettes were released from the plasmids through digestion with appropriate restriction enzyme pairs, then purified, and mixed with equal amounts of plasmid pAN7-1. The mixture was then used for co-transformation of T. reesei protoplasts. Candidate transformants were streaked twice on PDA plates that contained 100 μg/ml of hygromycin B, and then transferred to PDA plates to form conidia. For each expression cassette, twenty single colonies were selected for cultivation in Mandels medium supplemented with 4% glucose, and the activity of xylanase in the supernatant was analyzed. For each expression cassette, the single colony that exhibited the highest productivity was selected for further study.

Southern blot hybridization

The chromosomal DNA was extracted and purified by the phenol/chloroform method. The DNA was digested with SacI and BamHI, fractionated on 0.7% (w/v) agarose gels and then transferred to nylon membranes (Roche). High-stringency probing was carried out at 50 °C overnight using digoxigenin (DIG)-labeled DNA probes, which were produced by amplifying a 494 bp fragment of the T.reesei xyn2 gene with the primers Probe-F (aatccgtggctgtggagaag) and Probe-R (tgcgtgcggtaaatgtcgta) and labeled with digoxigenin DNA labeling mix (Roche). Chromogenic signal detection was done with the detection system from Roche Molecular Biochemicals. NBT/BCIP was used as the Chromogenic substrate.

Enzyme assays and protein analysis

For recombinant xylanase production, about 105 spores of the recombinant T. reesei strains were inoculated into 30 ml of Mandels medium, and maintained at 28°C and 250 r/min for 48 h. Then, 1.5 ml of the above culture was transferred into 30 ml of a modified Mandels medium, and maintained at 28°C and 250 r/min for about 192 h. In the modified minimal medium, the glucose concentration was raised from 2% to 7%, concentration of peptone from 0.5% to 1%, and 5% soybean powder was added. Xylanase activity was assayed as described in Bailey et al. with birchwood xylan (Sigma-Aldrich) as the substrate [35]. The culture supernatant was assayed for total cellulase activity as previously described by using two different substrates: 2% (w/v) carboxy methyl cellulose (CMC) and filter paper (Whatman No.1) [36]. One unit of enzyme activity (IU) was defined as the amount of enzyme that released 1 μmol reducing sugar per minute at 50°C.

Total protein concentration in the culture supernatant was determined by using a Bradford reagent kit (Sangon Biotech, China). Sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) was performed in 12.5% polyacrylamide gel slabs as described in Laemmli [37]. Three μl of each sample was mixed with 10 μl sample-loading buffer, boiled for 5 min, and loaded into the sample well. Proteins were stained with Coomassie Brilliant Blue R-250 (Sangon Biotech, China). The amount of protein in the SDS-PAGE bands was estimated by densitometry through the use of a Furi FR-200A ultraviolet analyzer (Furi Tech, China).

Competing interests

The authors declare that they have no competing interests

Author’s contributions

GL and JW designed the experiments and wrote the manuscript. JXL performed most of the experiments. SWW participated in RT-qPCR experiments and fugal transformation. MX participated in enzyme and protein concentration assay. SWY participated in construction of expression cassettes. All authors read and approved the final manuscript.

Acknowledgements

This work was partly supported by the National Natural Science Foundation of China (No. 31070044), Shenzhen Municipal Science and Technology Basic Research Program (JC201005280559A), and Shenzhen Municipal Science and Technology key projects of Basic Research Program (JC201005250041A).

References

  1. Wang BB, Xia LM: High efficient expression of cellobiase gene from Aspergillus niger in the cells of Trichoderma reesei.

    Biores Technol 2011, 102(6):4568-4572. Publisher Full Text OpenURL

  2. Rahman Z, Shida Y, Furukawa T, Suzuki Y, Okada H, Ogasawara W, Morikawa Y: Evaluation and characterization of Trichoderma reesei cellulase and xylanase promoters.

    Appl Microbiol Biotechnol 2009, 82(5):899-908. PubMed Abstract | Publisher Full Text OpenURL

  3. Nevalainen KMH, Te’o VSJ, Bergquist PL: Heterologous protein expression in filamentous fungi.

    Trends Biotechnol 2005, 23(9):468-474. PubMed Abstract | Publisher Full Text OpenURL

  4. Schuster A, Schmoll M: Biology and biotechnology of Trichoderma.

    Appl Microbiol Biotechnol 2010, 87(3):787-799. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  5. Markov AV, Gusakov AV, Kondratyeva EG, Okunev ON, Bekkarevich AO, Sinitsyn AP: New effective method for analysis of the component composition of enzyme complexes from Trichoderma reesei.

    Biochem (Moscow) 2005, 70(6):657-663. Publisher Full Text OpenURL

  6. Margeot A, Hahn-Hagerdal B, Edlund M, Slade R, Monot F: New improvements for lignocellulosic ethanol.

    Curr Opin Biotechnol 2009, 20(3):372-380. PubMed Abstract | Publisher Full Text OpenURL

  7. Zou G, Shi S, Jiang Y, van den Brink J, de Vries RP, Chen L, Zhang J, Ma L, Wang C, Zhou Z: Construction of a cellulase hyper-expression system in Trichoderma reesei by promoter and enzyme engineering.

    Microb Cell Fact 2012, 11:21. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  8. Joosten V, Lokman C, van den Hondel CAMJJ, Punt PJ: The production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi.

    Microb Cell Fact 2003, 2:1. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  9. Bergquist P, Te’o V, Gibbs M, Cziferszky A, de Faria F, Azevedo M, Nevalainen H: Expression of xylanase enzymes from thermophilic microorganisms in fungal hosts.

    Extremophiles 2002, 6(3):177-184. PubMed Abstract | Publisher Full Text OpenURL

  10. Liu T, Wang T, Li X, Liu X: Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization.

    Acta Biochim Biophys Sin (Shanghai) 2008, 40(2):158-165. Publisher Full Text OpenURL

  11. Xu J, Nogawa M, Okada H, Morikawa Y: Regulation of xyn3 gene expression in Trichoderma reesei PC-3-7.

    Appl Microbiol Biotechnol 2000, 54(3):370-375. PubMed Abstract | Publisher Full Text OpenURL

  12. Mach RL, Zeilinger S: Regulation of gene expression in industrial fungi: Trichoderma.

    Appl Microbiol Biotechnol 2003, 60(5):515-522. PubMed Abstract | Publisher Full Text OpenURL

  13. Seiboth B, Gamauf C, Pail M, Hartl L, Kubicek CP: The D-xylose reductase of Hypocrea jecorina is the major aldose reductase in pentose and D-galactose catabolism and necessary for beta-galactosidase and cellulase induction by lactose.

    Mol Microbiol 2007, 66(4):890-900. PubMed Abstract | Publisher Full Text OpenURL

  14. Gusakov AV: Alternatives to Trichoderma reesei in biofuel production.

    Trend Biotechnol 2011, 29(9):419-425. Publisher Full Text OpenURL

  15. Nakari-Setala T, Penttila M: Production of Trichoderma reesei cellulases on glucose-containing media.

    Appl Environ Microbiol 1995, 61(10):3650-3655. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  16. Delgado-Jarana J, Pintor-Toro J, Benitez T: Overproduction of β-1,6-glucanase in Trichoderma harzianum is controlled by extracellular acidic proteases and pH.

    Biochim Biophysic Acta 2000, 1481(2):289-296. Publisher Full Text OpenURL

  17. Kurzatkowski W, Törrönen A, Filipek J, Mach RL, Herzog P, Sowka S, Kubicek CP: Glucose-induced secretion of Trichoderma reesei Xylanases.

    Appl Environ Microbiol 1996, 62(8):2859-2865. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  18. Ilmén M, Onnela ML, Klemsdal S, Keränen S, Penttilä M: Functional analysis of the cellobiohydrolase I promoter of the filamentous fungus Trichoderma reesei.

    Mol Gen Genet 1996, 253(3):303-314. PubMed Abstract OpenURL

  19. Chambergo FS, Bonaccorsi ED, Ferreira AJ, Ramos AS, Ferreira JR, Abrahao-Neto J, Farah JP, El-Dorry H: Elucidation of the metabolic fate of glucose in the filamentous fungus Trichoderma reesei using expressed sequence tag (EST) analysis.

    J Biol Chem 2002, 277(16):13983-13988. PubMed Abstract | Publisher Full Text OpenURL

  20. La Grange DC, Pretorius IS, Van Zyl WH: Expression of a Trichoderma reesei β-xylanase gene (XYN2) in Saccharomyces cerevisiae.

    Appl Environ Microbiol 1996, 62(3):1036-1044. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  21. He J, Yu B, Zhang KY, Ding XM, Chen DW: Expression of endo-1, 4-beta-xylanase from Trichoderma reesei in Pichia pastoris and functional characterization of the produced enzyme.

    BMC Biotechnol 2009, 9:56. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  22. He J, Yu B, Zhang KY, Ding XM, Chen DW: Expression of a Trichoderma reesei β-xylanase gene in Escherichia coli and the activity of the enzyme on fiber-bond substrates.

    Protein Expr Purif 2009, 67(1):1-6. PubMed Abstract | Publisher Full Text OpenURL

  23. Stadlmayr G, Mecklenbrauker A, Rothmüller M, Maurer M, Sauer M, Mattanovich D, Gasser B: Identification and characterization of novel Pichia pastoris promoters for heterologous protein production.

    J Biotechnol 2010, 150(4):519-529. PubMed Abstract | Publisher Full Text OpenURL

  24. Partow S, Siewers V, Bjorn S, Nielsen J, Maury J: Characterization of different promoters for designing a new expression vector in Saccharomyces cerevisiae.

    Yeast 2010, 11(27):955-964. OpenURL

  25. Waterham HR, Digan ME, Koutz PJ, Lair SV, Cregg JM: Isolation of the Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase gene and regulation and use of its promoter.

    Gene 1997, 186(1):37-44. PubMed Abstract | Publisher Full Text OpenURL

  26. Xiong HR, von Weymarn N, Turunen O, Leisola M, Pastinen O: Xylanase production by Trichoderma reesei Rut C-30 grown on L-arabinose-rich plant hydrolysates.

    Biores Technol 2005, 96(7):753-759. Publisher Full Text OpenURL

  27. Beg OK, Kappor M, Mahajan L, Hoondal GS: Microbial xylanases and their industrial applications: a review.

    Appl Microbiol Biotechnol 2001, 56(3–4):326-338. PubMed Abstract | Publisher Full Text OpenURL

  28. Bergquist P, Te’o V, Gibbs M, Cziferszky A, de Faria FB Fabricia Paula, Azevedo M, Nevalainen H: Expression of xylanase enzymes from thermophilic microorganisms in fungal hosts.

    Extremophiles 2002, 6(3):177-184. PubMed Abstract | Publisher Full Text OpenURL

  29. Nevalainen KMH, Te’o VSJ, Bergquist PL: Heterologous protein expression in filamentous fungi.

    Trend Biotechnol 2005, 23(9):468-474. Publisher Full Text OpenURL

  30. Ruanglek V, Sriprang R, Ratanaphan N, Tirawongsaroj P, Chantasigh D, Tanapongpipat S, Pootanakit K, Eurwilaichitr L: Cloning, expression, characterization, and high cell-density production of recombinant endo-1, 4-β-xylanase from Aspergillus niger in Pichia pastoris.

    Enzyme Microb Technol 2007, 41(1–2):19-25. OpenURL

  31. Mandels M, Andreotti RE: Problems and changes in the cellulose to cellulase fermentation.

    Process Biochem 1978, 13(1):6-13. OpenURL

  32. Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJM: Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli.

    Gene 1987, 56(1):117-124. PubMed Abstract | Publisher Full Text OpenURL

  33. Miller GL: Use of dinitrosalicylic acid reagent for determination of reducing sugar.

    Anal Chem 1959, 31(3):426-428. Publisher Full Text OpenURL

  34. Steiger MG, Mach RL, Mach-Aigner AR: An accurate normalization strategy for RT-q PCR in Hypocrea jecorina (Trichoderma reesei).

    J Biotechnol 2010, 145(1):30-37. PubMed Abstract | Publisher Full Text OpenURL

  35. Bailey MJ, Biely P, Poutanen K: Interlaboratory testing of methods for assay of xylanase activity.

    J Biotechnol 1992, 23(3):257-270. Publisher Full Text OpenURL

  36. Ghose TK: Measurement of cellulase activities.

    Pure Appl Chem 1987, 59(9):257-268. OpenURL

  37. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

    Nature 1970, 259(227):680-685. OpenURL