Table 2

Primer sequences
Primer Sequence 5’ → 3’
GR180 TCTAGAGGCATCAAATAAAACGAAAGGCTC
GR181 GGTATATCTCCTGCATGCTTATGATTTATTTTG
GR219 GCATGCAGGAGAAAGGTCACatgaaggctgcagttgttacgaagg
GR220 TTTTATTTGATGCCTCTAGAttagtgacggaaatcaatcaccatg
GR221 GCATGCAGGAGAAAGGTCACatgcaaaatgaattgcagaccgcgc
GR222 TTTTATTTGATGCCTCTAGAttattgcgccgctgcgtacaggccg
GR223 GCATGCAGGAGAAAGGTCACatggcagcttcaacgttctttattc
GR224 TTTTATTTGATGCCTCTAGAttacatcgctgcgcgataaatcgcc
GR225 GCATGCAGGAGAAAGGTCACatgtcgatgataaaaagctatgccg
GR226 TTTTATTTGATGCCTCTAGAtcaaaaatcggctttcaacaccacg
GR227 GCATGCAGGAGAAAGGTCACAtgcaatttgactacatcattattg
GR228 TTTTATTTGATGCCTCTAGAtcattttttcgctctcaccggcatc
GR229 GCATGCAGGAGAAAGGTCACatgatggctaacagaatgattctga
GR230 TTTTATTTGATGCCTCTAGAttaccaggcggtatggtaaagctct
GR231 GCATGCAGGAGAAAGGTCACatgaatcaacaggatattgaacagg
GR232 TTTTATTTGATGCCTCTAGAttaaacaatgcgaaacgcatcgact
GR145 GGTACCTTTCTCCTCTTTAATGAA
GR146 TAATGACTCTAGAGGCATCAAATAA
GR147 ATTCATTAAAGAGGAGAAAGGTACCatgaaggctgcagttgttacgaagg
GR148 TTATTTGATGCCTCTAGAGTCATTAttagtgacggaaatcaatcaccatg
GR149 ATTCATTAAAGAGGAGAAAGGTACCatgcaaaatgaattgcagaccgcgc
GR150 TTATTTGATGCCTCTAGAGTCATTAttattgcgccgctgcgtacaggccg
GR151 ATTCATTAAAGAGGAGAAAGGTACCatggcagcttcaacgttctttattc
GR152 TTATTTGATGCCTCTAGAGTCATTAttacatcgctgcgcgataaatcgcc
GR153 ATTCATTAAAGAGGAGAAAGGTACCatgtcgatgataaaaagctatgccg
GR154 TTATTTGATGCCTCTAGAGTCATTAtcaaaaatcggctttcaacaccacg
GR188 ATTCATTAAAGAGGAGAAAGGTACCAtgcaatttgactacatcattattggtg
GR189 TTATTTGATGCCTCTAGAGTCATTAtcattttttcgctctcaccggcatc
GR190 ATTCATTAAAGAGGAGAAAGGTACCatgatggctaacagaatgattctgaac
GR191 TTATTTGATGCCTCTAGAGTCATTAttaccaggcggtatggtaaagctc
GR192 ATTCATTAAAGAGGAGAAAGGTACCatgaatcaacaggatattgaacaggtg
GR193 TTATTTGATGCCTCTAGAGTCATTAttaaacaatgcgaaacgcatcgact

Rodriguez and Atsumi

Rodriguez and Atsumi Microbial Cell Factories 2012 11:90   doi:10.1186/1475-2859-11-90

Open Data