<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1475-2859-5-29</ui>
   <ji>1475-2859</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Transcriptional analysis of the <it>recA </it>gene of <it>Streptococcus thermophilus</it></p>
         </title>
         <aug>
            <au id="A1">
               <snm>Giliberti</snm>
               <fnm>Gabriele</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>gabrielegiliberti@microbiologia.ca.it</email>
            </au>
            <au id="A2">
               <snm>Baccigalupi</snm>
               <fnm>Loredana</fnm>
               <insr iid="I1"/>
               <email>lorbacci@unina.it</email>
            </au>
            <au id="A3">
               <snm>Cordone</snm>
               <fnm>Angelina</fnm>
               <insr iid="I1"/>
               <email>acordone@unina.it</email>
            </au>
            <au id="A4">
               <snm>Ricca</snm>
               <fnm>Ezio</fnm>
               <insr iid="I1"/>
               <email>ericca@unina.it</email>
            </au>
            <au id="A5" ca="yes">
               <snm>De Felice</snm>
               <fnm>Maurilio</fnm>
               <insr iid="I1"/>
               <email>defelice@unina.it</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Dipartimento di Biologia Strutturale e Funzionale, Universit&#224; Federico II, Napoli, Italy</p>
            </ins>
            <ins id="I2">
               <p>Dipartimento di Scienze e Tecnologie Biomediche, Universit&#224; di Cagliari, Cittadella Universitaria, 09042 Monserrato, Cagliari, Italy</p>
            </ins>
         </insg>
         <source>Microbial Cell Factories</source>
         <issn>1475-2859</issn>
         <pubdate>2006</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>29</fpage>
         <url>http://www.microbialcellfactories.com/content/5/1/29</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16972988</pubid>
               <pubid idtype="doi">10.1186/1475-2859-5-29</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>23</day>
               <month>12</month>
               <year>2005</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>14</day>
               <month>9</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>14</day>
               <month>9</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Giliberti et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>RecA is a highly conserved prokaryotic protein that not only plays several important roles connected to DNA metabolism but also affects the cell response to various stress conditions. While RecA is highly conserved, the mechanism of transcriptional regulation of its structural gene is less conserved. In <it>Escherichia coli </it>the LexA protein acts as a <it>recA </it>repressor and is able, in response to DNA damage, of RecA-promoted self-cleavage, thus allowing <it>recA </it>transcription. The LexA paradigm, although confirmed in a wide number of cases, is not universally valid. In some cases LexA does not control <it>recA </it>transcription while in other RecA-containing bacteria a LexA homologue is not present.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We have studied the <it>recA </it>transcriptional regulation in <it>S. thermophilus</it>, a bacterium that does not contain a LexA homologue. We have characterized the promoter region of the gene and observed that its expression is strongly induced by DNA damage. The analysis of deletion mutants and of translational gene fusions showed that a DNA region of 83 base pairs, containg the <it>recA </it>promoter and the transcriptional start site, is sufficient to ensure normal expression of the gene. Unlike LexA of <it>E. coli</it>, the factor controlling <it>recA </it>expression in <it>S. thermophilus </it>acts in a RecA-independent way since <it>recA </it>induction was observed in a strain carrying a <it>recA </it>null mutation.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>In <it>S. thermophilus</it>, as in many other bacteria,<it>recA </it>expression is strongly induced by DNA damage, however, in this organism expression of the gene is controlled by a factor different from those well characterized in other bacteria. A small DNA region extending from 62 base pairs upstream of the <it>recA </it>transcriptional start site to 21 base pairs downstream of it carries all the information needed for normal regulation of the <it>S. thermophilus recA </it>gene.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The bacterial RecA protein has an important role in a variety of cellular processes, such as the control of DNA status, repair of stalled replication forks, double-strand break repair, general recombination, induction of the SOS response and induction of temperate phages <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. RecA has also been recently shown to possess other roles related to DNA metabolism, such as the apparent motor function in which DNA strand exchange is coupled to ATP hydrolysis <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. In addition, roles of RecA in degradation of pectin in <it>Erwinia carotovora </it><abbrgrp><abbr bid="B3">3</abbr></abbrgrp>, expression of adherence factors in <it>Vibrio cholerae </it><abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, pilus phase transition in <it>Neisseria gonorrhoeae </it><abbrgrp><abbr bid="B5">5</abbr></abbrgrp> and switching from pathogenic smooth to non-pathogenic rough cell form in <it>Pseudomonas tolaasii </it><abbrgrp><abbr bid="B6">6</abbr></abbrgrp>, have been proposed and explained as secondary effects of RecA action on DNA structure and function.</p>
         <p>However, RecA has been also associated to phenomena apparently not related to DNA metabolism, such as the adaptation of <it>Lactococcus lactis </it>to oxygen and heat shock <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp> and of <it>Bacillus subtilis </it>to nutrient starvation <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Also in the moderately thermophilic lactic acid bacterium <it>Streptococcus thermophilus recA </it>expression is involved in the stress response mechanism <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. <it>S. thermophilus </it>is a commercially important bacteria since it is used, along with <it>Lactobacillus </it>spp., as a starter culture for the manufacture of several fermented dairy foods. Its industrial use has substantially increased during the past two decades, as a result of the strong increase in consumption of dairy products. Such increase has led, as a consequence, to new demands on <it>S. thermophilus </it>performances, as stabile fermentation properties, consistent flavor and texture characteristics, resistance to bacteriophage infections. Research during the past two decades on the physiology of <it>S. thermophilus </it>has revealed important information on some of these properties, and more recently genome data have become publicly available <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Analysis of the <it>S. thermophilus </it>genome revealed a small size (1.8 Mb, probably the smallest genome of all lactic acid bacteria), a low G+C ratio (40%) and a phylogenetical relationship to mesophilic lactococci <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. A <it>recA </it>insertional mutant of <it>S. thermophilus</it>, in addition to typical <it>recA </it>phenotypes (reduced growth rate and sensitivity to mitomycin C-induced DNA damages) also showed a strong reduction of viability and the appearance of a sub-population of morphologically altered cells in response to both heat shock and nutrient starvation <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. These effects were independent from ClpL and GroEL homologues that were normally induced in the <it>recA </it>null mutant <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>The transcriptional regulation of the <it>recA </it>gene has been studied in a variety of different bacteria. In <it>E. coli</it>, as well as in several other organisms, under physiological conditions <it>recA </it>transcription is repressed by the LexA protein that binds to its consensus binding site located in the promoter region of <it>recA </it><abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. Upon DNA damage, RecA binds to single-stranded DNA regions generated by replication blocks, originating a nucleoprotein filament (RecA*) <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Activated RecA* possesses co-protease activity <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, required for self-cleavage of LexA <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. The RecA*-promoted self-cleavage of LexA results in the inactivation of the repressor and thus in the induction of the SOS regulon including the <it>recA </it>gene <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. In vitro experiments have shown that in the absence of RecA*, LexA is cleaved at high pH demonstrating that the protein is able to perform self-cleavage <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>.</p>
         <p>In the gram-positive model organism <it>Bacillus subtilis</it>, a LexA homologue is present and the <it>recA </it>gene is regulated with a mechanism similar to that studied in <it>E. coli</it>. The <it>E. coli </it>LexA and its <it>B. subtilis </it>homologue share a 52% similarity that becomes lower in the helix-turn-helix domain. As a consequence, the two proteins recognize different DNA target sites (5'-CTGTN<sub>8</sub>ACAG-3' for <it>E. coli </it>and 5'-CGAACN<sub>4</sub>GTTCG-3' for <it>B. subtilis</it>) <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>.</p>
         <p>In other bacteria different mechanisms of transcriptional regulation for the <it>recA </it>gene have been proposed. <it>Myxococcus xanthus </it>and <it>Deinococcus radiodurans</it>, although not similar to each other, both contain RecA and LexA homologues and control <it>recA </it>transcription with mechanisms that differ from the <it>E. coli </it>paradigm <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <p>In <it>L. lactis </it>while a highly conserved RecA homologue is present <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> a LexA homologue has not been found. In this organism a different protein, HdiR, not homologous to LexA, has been shown to regulate several genes of the SOS system but not <it>recA </it><abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. These evidence therefore suggest that while the RecA is highly conserved in prokaryotes, the mechanism of transcriptional regulation of its structural gene is less conserved.</p>
         <p>We analyze here the expression of the <it>recA </it>gene of <it>S. thermophilus </it>and report evidence that <it>recA </it>expression and DNA damage-induction are exerted in a RecA-independent fashion through a factor not homologous to those well characterized in other bacteria.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Mapping of the 5' terminus of the <it>recA </it>gene</p>
            </st>
            <p>Primer extension experiments were carried out to map the 5' terminus of <it>recA </it>mRNA. Two radioactively labelled synthetic primers, designated A3 and A4 (Methods) and annealing the proximal part of <it>recA </it>mRNA (Fig. <figr fid="F1">1A</figr>), were used to hybridize <it>S. thermophilus </it>total RNA. Since it had been previously reported <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp> that in several bacteria <it>recA </it>is expressed at a very low basal level and is transcriptionally induced by mitomycin C, we used total RNA from exponentially growing cells of <it>S. thermophilus </it>before and after exposure to sublethal concentration (20 ng/ml) of mitomycin C <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Reverse transcriptase was then used to generate cDNA primer extension products, which were separated by 6% polyacrilamide gel electrophoresis together with dideoxy sequencing ladders generated by using A3 and A4 primers and cloned <it>recA </it>DNA as a template. The results obtained with the A3 primer (Fig. <figr fid="F1">1B</figr>) were in agreement with the results obtained with the A4 primer (data not shown). The extension product obtained allowed us to localize the 5' terminus of <it>recA </it>mRNA 132 bp upstream of the beginning of the ORF. The extension product was found only when <it>recA </it>expression was induced with mitomycin C, suggesting that in <it>S. thermophilus recA </it>expression is strictly regulated. Sequences upstream of the 5' terminus (+1) resembled the conserved features of a typical promoter of an <it>E. coli </it>housekeeping gene, matching in three of six positions the consensus -10 and in four of six positions the consensus -35 (Fig. <figr fid="F1">1A</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>The <it>recA </it>promoter region of <it>S. thermophilus</it></p>
               </caption>
               <text>
                  <p><b>The <it>recA </it>promoter region of <it>S. thermophilus</it></b>. (A) Nucleotide sequence of the <it>recA </it>promoter region of <it>S. thermophilus</it>. Deduced amino acid sequence of the 30 N-terminal residues of RecA is also reported. Horizontal and vertical arrows indicate synthetic oligonucleotide used in the primer extension analysis and the transcriptional start point. Regions of homology with the -10 and -35 consensus sequences are underlined. (B) Primer extension analysis performed with total RNA extracted from exponentially growing cells of <it>S. thermophilus </it>before (lane 2) and after (lane 1) exposure to sublethal concentration (20 ng/ml) of mitomycin C [10]. Primer extension and sequencing reactions were primed with the synthetic oligonucleotide A3. Similar results were obtained with oligonucleotide A4 (data not shown).</p>
               </text>
               <graphic file="1475-2859-5-29-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p><it>recA </it>expression is induced by mitomycin C but not by heat shock or nutrient starvation</p>
            </st>
            <p>To analyze the expression of the <it>recA </it>gene we constructed a <it>recA::gusA </it>translational fusion. A 609 bp DNA fragment containing the <it>recA </it>promoter region and codons for 18 N-terminal amino acid residues of the <it>recA </it>ORF was amplified from <it>S. thermophilus </it>chromosomal DNA by using oligonucleotides P1 and P5 as primers (Methods). The PCR product was then fused in frame to the <it>gusA </it>gene of <it>E. coli </it>carried by plasmid pGU0, previously obtained by inserting the <it>gusA </it>coding region in the <it>Eco</it>RI site of the commercial plasmid pGemT-easy (Promega). The recombinant plasmid obtained, pGU1, was then used as a template for DNA sequencing reactions performed to verify that the <it>recA </it>and <it>gusA </it>genes were fused in frame (not shown).</p>
            <p>The gene fusion was then transferred into the <it>E. coli &#8211; S. thermophilus </it>shuttle vector pNZ124, yielding plasmid pNG1 that was used to transform competent cells of the <it>S. thermophilus </it>strain Sfi39. The recombinant strain, S1, was grown at 42&#176;C anaerobically in the presence and in the absence of a sublethal concentration (200 ng/ml) of mitomycin C <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> and exponentially growing cells collected by centrifugation and assayed for &#946;-glucuronidase activity (Methods). Although the conditions of mitomycin induction differed substantially between the primer extension of Fig. <figr fid="F1">1B</figr> (20 ng/ml) and the &#946;-glucuronidase assay of Fig. <figr fid="F2">2</figr> (200 ng/ml) the two experiments together indicated that <it>recA </it>is poorly expressed in uninduced conditions and is strongly induced by mitomycin addition to the growth medium.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p><it>recA</it>-driven &#946;-glucuronidaseactivity</p>
               </caption>
               <text>
                  <p><b><it>recA</it>-driven &#946;-glucuronidaseactivity</b>. Levels of &#946;-glucuronidase activity in <it>S. thermophilus </it>strain Sfi39 containing the translational <it>recA::gusA</it>. Samples were harvested from exponentially growing cells, from exponential cells exposed to a sublethal concentration (200 ng/ml) of mitomycin C [10] or to heat-shock or nutrient starvation. Data are the average of three independent experiments.</p>
               </text>
               <graphic file="1475-2859-5-29-2"/>
            </fig>
            <p>Since <it>recA </it>expression is involved in the cell response to heat shock and nutrient starvation <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>, we decided to verify whether these stress conditions affected <it>recA </it>expression. Strain S1 was then grown at 42&#176;C anaerobically to mid exponential phase and shifted at 50&#176;C for three hours as previously reported <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. A parallel culture was grown at 42&#176;C for 48 hours to induce nutrient starvation, as previously reported <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Cell samples were collected and assayed for &#946;-glucuronidase activity (Methods). In both stress conditions, the <it>recA</it>-driven &#946;-glucuronidase activity was similar to that measured in exponentially growing cells not exposed to heat shock or nutrient starvation, thus indicating that both conditions do not affect <it>recA </it>expression (Fig. <figr fid="F2">2</figr>).</p>
            <p>Results obtained with the primer extension experiment of Fig. <figr fid="F1">1</figr> together with the analysis of the <it>recA</it>-driven &#946;-glucuronidase activity of Fig. <figr fid="F2">2</figr>, suggest that expression of the <it>recA </it>gene is transcriptionally controlled and is inducible by DNA damages, caused in laboratory conditions by the presence of mitomycin C in the growth medium <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Activation of <it>recA </it>expression is not RecA-dependent</p>
            </st>
            <p>A computer-assisted analysis of the recently released <it>S. thermophilus </it>genome <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> failed to reveal homologues of the <it>E. coli </it>or <it>Bacillus subtilis </it>LexA proteins (not shown). This analysis, however, identified in the <it>S. thermophilus </it>genome a homologue (YP_139374) of the HdiR protein that in <it>L. lactis </it>acts as transcriptional regulator of various SOS genes <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Although HdiR does not control the expression of <it>recA </it>in <it>L. lactis </it><abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, we searched for the HdiR putative consensus sequence (5'-tttATCAGtTtttCTGATaaa-3') <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> in the <it>recA </it>promoter region of <it>S. thermophilus</it>. Since no sequences matching the putative consensus for HdiR binding were found and since HdiR is not involved in <it>recA </it>regulation in the phylogenetically related <it>L. lactis</it>, it is likely that the protein controlling <it>recA </it>expression in <it>S. thermophilus </it>is not the HdiR homologue, YP_139374. Additional support for this conclusion comes also from the observation that HdiR acts in <it>L. lactis </it>in a RecA-dependent way <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> while the <it>S. thermophilus </it>factor is RecA-independent (see below).</p>
            <p>Since in LexA-containing bacteria DNA damage-induction is RecA-promoted <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>, we decided to verify whether in <it>S. thermophilus </it>such induction, although mediated by a different protein, was still under RecA control. To evaluate <it>recA </it>expression in a wild type and a <it>recA </it>null mutant we performed RT-PCR experiments with the synthetic primers, A4 and A5 (Methods). Total RNA was extracted from exponentially growing cells of the wild type and the <it>recA </it>null mutant strain before and after exposure to sublethal concentration (20 ng/ml) of mitomycin C <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> and measured spectrophotometrically. One-step reverse transcription-PCR (RT-PCR) were carried out by using a Access RT-PCR Kit (Promega). PCR products were analyzed by electrophoresis on a 2% agarose gel and the linearity of the reactions tested amplifying the 16S RNA gene by using various amounts of RNA for each sample as templates. Equal amounts of RNA were then used as templates in RT-PCR reactions to amplify the <it>recA </it>gene. As reported in Fig. <figr fid="F3">3</figr>, <it>recA </it>transcription was induced by sublethal concentration (20 ng/ml) of mitomycin C in both the wild type and the <it>recA </it>mutant strain. The induction conditions used for the experiment of Fig. <figr fid="F3">3</figr> were identical to those used for the primer extension of Fig. <figr fid="F1">1B</figr> and the observation that a basal level of expression can be seen in Fig. <figr fid="F3">3</figr> but not in Fig. <figr fid="F1">1B</figr> is most likely due to the higher sensitivity of the PCR-based approach.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Effects of RecA on <it>recA </it>transcription</p>
               </caption>
               <text>
                  <p><b>Effects of RecA on <it>recA </it>transcription</b>. RT-PCR analysis performed on total RNA extracted from a wild type and a congenic strain containing a <it>recA </it>null mutation [10]. RNA was extracted from exponentially growing cells before or after exposure to sublethal concentration (20 ng/ml) of mitomycin C [10]. The 16S RNA gene was used as a standard to calibrate the amount of RNA to be used with synthetic oligonucleotides amplifying the <it>recA </it>gene.</p>
               </text>
               <graphic file="1475-2859-5-29-3"/>
            </fig>
            <p>These results indicate that the mitomycin-mediated induction of <it>recA </it>expression is controlled in <it>S. thermophilus </it>by a mechanism not requiring RecA, and thus different from those so far described in other bacteria.</p>
         </sec>
         <sec>
            <st>
               <p>Minimal DNA region needed for <it>recA </it>repression and induction</p>
            </st>
            <p>To study the mechanism controlling <it>recA </it>expression in <it>S. thermophilus </it>in more details we performed a deletion analysis of the <it>recA </it>promoter region. We started our analysis from plasmid pNG1, containing 417 bp upstream and 191 bp downstream of the <it>recA </it>transcriptional start site, and sufficient to ensure regulation and strong induction of the gene (Fig. <figr fid="F2">2</figr>). Similarly to what described for the construction of plasmid pNG1, a PCR-based strategy was followed to obtain plasmids in which the 609 bp insert of pNG1 was shortened at its 5' end of 89 (pNG2), 301 (pNG3) and 355 (pNG4) bp (Fig. <figr fid="F4">4</figr>). All plasmids were independently used to transform competent cells of the <it>S. thermophilus </it>strain Sfi39. Recombinant strains S1 (pNG1), S2 (pNG2), S3 (pNG3) and S4 (pNG4), were all grown anaerobically at 42&#176;C and exponential cells collected and assayed for &#946;-glucuronidase activity. As shown in Fig. <figr fid="F4">4</figr>, similar levels of &#946;-glucuronidase activity were observed in all strains grown in the presence or in the absence of mitomycin C (200 ng/ml). These results therefore indicated that DNA carried by plasmid pNG4 contains all signals needed for the transcriptional regulation of the gene.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Deletion analysis of the <it>recA </it>regulatoryregion</p>
               </caption>
               <text>
                  <p><b>Deletion analysis of the <it>recA </it>regulatoryregion</b>. The various plasmids carrying the <it>recA </it>promoter region translationally fused to the <it>gusA </it>gene and the &#946;-glucuronidase activities obtained from cells containing those plasmids grown without and with sublethal concentration (200 ng/ml) of mitomycin C [10] are reported. For each plasmid transcriptional and translational start points are indicated. The extension of <it>S. thermophilus </it>DNA carried by each plasmid is indicated referring to the transcriptional start point as +1. Enzymatic data are the average of three independent experiments.</p>
               </text>
               <graphic file="1475-2859-5-29-4"/>
            </fig>
            <p>As determined with the primer extention of Fig. <figr fid="F1">1</figr>, the <it>S. thermophilus recA </it>gene has a 132 bp DNA region that is transcribed but not translated. To verify whether this region, present in plasmid pNG4, contains transcriptional signals we constructed plasmid pNG5 (Methods), carrying a 75 bp deletion within the 132 bp untranslated region (Fig. <figr fid="F4">4</figr>). Strain S5, carrying plasmid pNG5, was then assayed in parallel with strains S1, S2, S3 and S4 and showed similar levels of &#946;-glucuronidase activity both in the absence and in the presence of the inducer mitomycin C (Fig. <figr fid="F4">4</figr>).</p>
            <p>Our deletion analysis indicate that a DNA fragment of 83 bp, extending from 62 bp upstream and 21 bp downstream of the transcriptional start site, has all the information for regulation and full induction of the <it>recA </it>gene.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>1) We have characterized the <it>recA </it>promoter region of <it>S. thermophilus </it>and observed that expression of the gene is strictly regulated and induced by DNA damages.</p>
         <p>2) Although RecA is required for <it>S. thermophilus </it>response to heat shock and nutrient starvation, expression of its structural gene is not affected by either stress condition.</p>
         <p>3) Although functionally homologous to the LexA protein of other bacteria, the <it>S. thermophilus </it>protein controlling <it>recA </it>expression is not a structural homolog of LexA.</p>
         <p>4) Unlike LexA of <it>E. coli</it>, the <it>S. thermophilus </it>protein controlling <it>recA </it>expression acts in a RecA-independent fashion.</p>
         <p>5) An 83 bp DNA fragment containing the <it>recA </it>promoter and extending from 62 bp upstream to 21 bp downstream of the transcriptional start site, has all signals for regulation of the gene.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Bacterial strains, growth conditions and bacterial transformation</p>
            </st>
            <p>Strains used were <it>S. thermophilus </it>Sfi39 <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> and <it>E. coli </it>DH5&#945; <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. <it>S. thermophilus </it>was grown in anaerobic conditions in either HJL liquid medium or LM17 (lactose supplemented M17) solid medium <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. The <it>E. coli </it>strain was grown aerobically in LB medium <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
            <p><it>S. thermophilus </it>and <it>E. coli </it>cells were transformed with plasmid DNA as previously described by electroporation <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> and by CaCl<sub>2</sub>-treatment <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>, respectively.</p>
         </sec>
         <sec>
            <st>
               <p>Primer extension analysis</p>
            </st>
            <p>Total RNA was extracted from exponentially growing cells before and after exposure to 20 ng/ml mitomycin C, by use of the RNeasy kit (QIAGEN). 50 &#956;g of total RNA were used with &#947;<sup>32</sup>PdATP (NEN) labeled oligonucleotides (A3: 5'-CCTCTTCTTTCTGTG-3' and A4: 5'-CAACGCTCATCACCAA-3'), dNTP and AMV Reverse transcriptase (BRL) to prime cDNA synthesis, as previously described <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Reaction products were fractionated on 8M urea &#8211; 6% polyacrilamide gels alongside with DNA sequencing reactions primed with the same oligonucleotide.</p>
         </sec>
         <sec>
            <st>
               <p>Reverse transcription-PCR analysis</p>
            </st>
            <p>Total RNA was extracted from a wild type and a isogenic strain carrying a <it>recA </it>null mutation before and after 30 min of exposure to 20 ng/ml of mitomicin C by use of RNeasy kit (Qiagen). Each RNA sample was treated with DNAse turbo (Ambion) following manufacturer instructions and the amount of RNA determined by spectophotometer. Identical amounts of RNA (200 ng) were then used in one-step RT-PCR experiments using ACCESS RT-PCR SYSTEM (Promega) and primer sets specific for the <it>recA </it>gene (A4: GGTGGAAGAAGTCGATCTGATG; A5 CCTTGCTCACCAGAATCAGGC) and for the 16S ribosomal gene (16S-for: CCGCAGCTAACGCATTAAGC; 16S-rev: GACTCGCAACTCGTTGTACC) used as RNA concentration control. PCRs were carried out with RNA alone to exclude that the amplification products could derive from contaminating genomic DNA.</p>
         </sec>
         <sec>
            <st>
               <p>Plasmid construction</p>
            </st>
            <p>pGU0 plasmid was obtained by inserting a DNA fragment with <it>Eco</it>RI flanking ends and coding for the <it>gusA </it>gene of <it>E. coli </it>into the pGEMT-easy plasmid (PROMEGA) previously digested with the same restriction enzyme. A 609 bp DNA fragment, containing the <it>recA </it>promoter region (417 nucleotides upstream and 191 downstream transcriptional start site) was PCR amplified using <it>S. thermophilus </it>chromosomal DNA as a template and oligonucleotides P1 (5'-GCTTGCTGATCTCATCT-3') and P5 (5'-AAACCATGGCTCATCAT CACCAAACTTC-3') as primers. The PCR fragment was digested with the <it>Not</it>I restriction enzyme and cloned into pGU0, previously digested with the same enzyme, yielding plasmid pGU1.</p>
            <p>The <it>recA::gusA </it>translational fusion was then moved by using <it>Sac</it>I and <it>SphI/NspI </it>restriction sites, in the pNZ124 vector, able to produce a RepA protein and, as a consequence, to replicate in <it>S. thermophilus</it>. The resulting plasmid, pNG1, was then used to transform competent cells of <it>S. thermophilus </it>strain Sfi39.</p>
            <p>An identical strategy was followed to obtain plasmids pNG2, pNG3, pNG4 (containing respectively 328, 116 and 62 nucleotides upstream of the transcriptional start site) by pairing with primer P5 primers: P2 (5'-CTGCAGCTGAAAGTTTAACAGCTGG-3'), P3 (5'-GTGATTACGGAATTGCGCTTACTGGAGTAG-3') and P4 (5'-GCAGGTACAGTCTTTATTGG-3'), respectively.</p>
            <p>Plasmid pNG5 was obtained by performing PCR reactions on pNG4 DNA as a template and oligonucleotides SMF1 (5'-AAACT<ul>CCCGGG</ul>TCAGATCGACTTCTTCCACC-3'; underlined is a <it>Sma</it>I site)-SM1 (5'-AAAATTTTCCAGCGCTACCGCTCG-3') and SMF2 (5'-TCTGA<ul>CCCGGG</ul>AGTTTGTCATTTAACACAG-3'; underlined is a <it>Sma</it>I site)-SM2 (5'-CACCAACGCTGATCAATTCCACAG-3') as primer pairs. Amplified fragments were independently cloned into pGEM-Teasy vectors and the recombinant plasmids double digested with <it>Sma</it>I (inserted with oligonucleotides SMF1 and SMF2) and <it>Sca</it>I (present in pGEM-Teasy). Released DNA fragments of 1.564 and 2.090 bp were then ligated to produce an intermediate vector carrying the <it>recA </it>fragment of plasmid pNG4 with an internal deletion. This fragment was then used to replace the wild type <it>recA </it>sequence of pNG4 by double digestion with <it>Aor</it>51HI and <it>Ava</it>II restriction enzymes.</p>
         </sec>
         <sec>
            <st>
               <p>&#946;-glucuronidase assays</p>
            </st>
            <p>&#946;-glucuronidase assays were performed as previously described <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. For each sample a graph of <it>A</it><sub>405 </sub>(Y-axis) versus time in minutes (X-axis) was designed; the slope <it>S </it>of the graph in <it>A</it><sub>405</sub>units per minute was estimated and units of activity (nanomoles of <it>p</it>-nitrophenyl glucuronide hydrolysed per minute) were calculated from <it>S</it>/V<sub><it>e </it></sub>&#215; 0.02; where V<sub><it>e </it></sub>is the volume of permeabilized cells in ml and 0.02 represents <it>A</it><sub>405 </sub>given relative to 1 nmol of product produced. Specific activity equals units per <it>A</it><sub>590</sub>. Values reported here were the average of at least three independent experiments. Statistical significance was determined by Student's <it>t </it>test and the significance level was set at <it>P </it>&lt; 0.05.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>GG performed most of the experiments; LB performed the RT-PCR analysis of Fig. <figr fid="F3">3</figr>; AC contributed to plasmids construction and enzymatic assays; ER contributed to experiment design and discussion; MDF contributed discussions and suggestions during the work and helped in the preparation of the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank L. Di Iorio for technical assistance. This work was partially supported by Centro Regionale di Competenza BioTekNet, Naples, Italy.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The bacterial RecA protein and the recombinational DNA repair of stalled replication forks</p>
            </title>
            <aug>
               <au>
                  <snm>Lusetti</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Cox</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Annu Rev Biochem</source>
            <pubdate>2002</pubdate>
            <volume>71</volume>
            <fpage>71</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.biochem.71.083101.133940</pubid>
                  <pubid idtype="pmpid" link="fulltext">12045091</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>The bacterial RecA protein as a motor protein</p>
            </title>
            <aug>
               <au>
                  <snm>Cox</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Annu Rev Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>57</volume>
            <fpage>551</fpage>
            <lpage>577</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.micro.57.030502.090953</pubid>
                  <pubid idtype="pmpid" link="fulltext">14527291</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Genetic evidence foran activator required for induction of pectin lyase in <it>Erwinia carotovora </it>sbsp. <it>carotovora </it>by DNA-damaging agents</p>
            </title>
            <aug>
               <au>
                  <snm>McEvoy</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Murata</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Chatterjee</snm>
                  <fnm>AK</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1992</pubdate>
            <volume>174</volume>
            <fpage>5471</fpage>
            <lpage>5474</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">206390</pubid>
                  <pubid idtype="pmpid">1644776</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p><it>recA </it>mutations reduce adherence and colonization byclassical and EI Tor strains of <it>Vibrio cholerae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kumar</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Srivastava</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sinha</snm>
                  <fnm>VB</fnm>
               </au>
               <au>
                  <snm>Michalski</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kaper</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Srivastava</snm>
                  <fnm>BS</fnm>
               </au>
            </aug>
            <source>Microbiol</source>
            <pubdate>1994</pubdate>
            <volume>140</volume>
            <fpage>1217</fpage>
            <lpage>1222</lpage>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Effects of <it>recA </it>mutations on pilus antigenicvariation and phase transition in <it>Neisseria gonorroheae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Koomey</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gotschlich</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Robbins</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bergstrom</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Swanson</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1987</pubdate>
            <volume>117</volume>
            <fpage>391</fpage>
            <lpage>398</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1203215</pubid>
                  <pubid idtype="pmpid" link="fulltext">2891588</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Analysis of the role of <it>recA </it>in phenotypic switching of <it>Pseudomonas tolaasii</it></p>
            </title>
            <aug>
               <au>
                  <snm>Sinha</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Pain</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Johnstone</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2000</pubdate>
            <volume>182</volume>
            <fpage>6532</fpage>
            <lpage>6535</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">94806</pubid>
                  <pubid idtype="pmpid" link="fulltext">11053404</pubid>
                  <pubid idtype="doi">10.1128/JB.182.22.6532-6535.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>The <it>recA </it>gene of <it>Lactococcus lactis</it>: characterization and involvement in oxidative and thermal stress</p>
            </title>
            <aug>
               <au>
                  <snm>Duwat</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ehrlich</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Gruss</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1995</pubdate>
            <volume>17</volume>
            <fpage>1121</fpage>
            <lpage>1131</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2958.1995.mmi_17061121.x</pubid>
                  <pubid idtype="pmpid">8594331</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Heat and DNA damage induction of the LexA-like regulator HdiR from <it>Lactococcus lactis </it>is mediated by RecA and ClpP</p>
            </title>
            <aug>
               <au>
                  <snm>Savijoki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ingmer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Frees</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Vogensen</snm>
                  <fnm>FK</fnm>
               </au>
               <au>
                  <snm>Palva</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Varmanen</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>50</volume>
            <fpage>609</fpage>
            <lpage>621</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.2003.03713.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14617183</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Growth phase variation in cell and nucleoid morphology in a <it>Bacillus subtilis recA </it>mutant</p>
            </title>
            <aug>
               <au>
                  <snm>Sciocchetti</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Blakely</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Piggot</snm>
                  <fnm>PJ</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2001</pubdate>
            <volume>183</volume>
            <fpage>2963</fpage>
            <lpage>2968</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">99517</pubid>
                  <pubid idtype="pmpid" link="fulltext">11292820</pubid>
                  <pubid idtype="doi">10.1128/JB.183.9.2963-2968.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Alteration of cell morphology and viability in a <it>recA </it>mutant of <it>Streptococcus thermophilus </it>upon induction of heat shock and nutrient starvation</p>
            </title>
            <aug>
               <au>
                  <snm>Giliberti</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Naclerio</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Martirani</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Ricca</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>De Felice</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>2002</pubdate>
            <volume>295</volume>
            <fpage>1</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1119(02)00830-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">12242004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <url>http://www.biol.ucl.ac.be/gene/genome/</url>
         </bibl>
         <bibl id="B12">
            <title>
               <p>New insights in the molecular biology and physiology of Streptococcus thermophilus revealed by comparative genomics</p>
            </title>
            <aug>
               <au>
                  <snm>Hols</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hancy</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Fontaine</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Grossiord</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Prozzi</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Leblond-Bourget</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Decaris</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bolotin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Delorme</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dusko Ehrlich</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Guedon</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Monnet</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Renault</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kleerebezem</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Rev</source>
            <pubdate>2005</pubdate>
            <volume>29</volume>
            <fpage>435</fpage>
            <lpage>463</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.femsre.2005.04.008</pubid>
                  <pubid idtype="pmpid" link="fulltext">16125007</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Identification of additional genes belonging to the LexA regulon in <it>Escherichia coli </it></p>
            </title>
            <aug>
               <au>
                  <snm>Fernandez de Henestrosa</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Ogi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Aoyagi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chafin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hayes</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Ohmori</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Woodgate</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>35</volume>
            <fpage>1560</fpage>
            <lpage>1572</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.2000.01826.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10760155</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Comparative gene expression pro-files following UV exposure in wt and SOS-deficient <it>Escherichia coli </it></p>
            </title>
            <aug>
               <au>
                  <snm>Courcelle</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Khodursky</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Peter</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>PO</fnm>
               </au>
               <au>
                  <snm>Hanawalt</snm>
                  <fnm>PC</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2001</pubdate>
            <volume>158</volume>
            <fpage>41</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1461638</pubid>
                  <pubid idtype="pmpid" link="fulltext">11333217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Biochemistry of homologous recombination in <it>Escherichia coli </it></p>
            </title>
            <aug>
               <au>
                  <snm>Kowalczykowski</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Dixon</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Eggleston</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Lauder</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rehrauer</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>Microbiol Rev</source>
            <pubdate>1994</pubdate>
            <volume>58</volume>
            <fpage>401</fpage>
            <lpage>465</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">372975</pubid>
                  <pubid idtype="pmpid">7968921</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>LexA and lambda Cl repressors as enzymes, specific cleavage in an intermolecular reaction</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Little</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1993</pubdate>
            <volume>73</volume>
            <fpage>1165</fpage>
            <lpage>1173</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(93)90645-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">8513500</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Mutant LexA proteins with an increased rate of in vivo cleavage</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Cavenagh</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Little</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1991</pubdate>
            <volume>88</volume>
            <fpage>7356</fpage>
            <lpage>7360</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">52294</pubid>
                  <pubid idtype="pmpid" link="fulltext">1908093</pubid>
                  <pubid idtype="doi">10.1073/pnas.88.16.7356</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>The <it>Bacillus subtilis </it>DinR binding site:redefinition of the consensus sequence</p>
            </title>
            <aug>
               <au>
                  <snm>Winterling</snm>
                  <fnm>KW</fnm>
               </au>
               <au>
                  <snm>Chafin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hayes</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Levine</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Yasbin</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Woodgate</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1998</pubdate>
            <volume>180</volume>
            <fpage>2201</fpage>
            <lpage>2211</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">107149</pubid>
                  <pubid idtype="pmpid" link="fulltext">9555905</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>LexA-independent DNA damage-mediated induction of gene expression in <it>Myxococcus xanthus</it></p>
            </title>
            <aug>
               <au>
                  <snm>Campoy</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fontes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Padmanabham</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cortes</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Montserrat</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Barb&#232;</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>49</volume>
            <fpage>769</fpage>
            <lpage>781</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.2003.03592.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12864858</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The LexA protein from Deinococcus radiodurans is not involved in RecA induction following gamma irradiation</p>
            </title>
            <aug>
               <au>
                  <snm>Narumi</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Satoh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kikushi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Funayama</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yanagisawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2001</pubdate>
            <volume>183</volume>
            <fpage>6951</fpage>
            <lpage>6956</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">95538</pubid>
                  <pubid idtype="pmpid" link="fulltext">11698386</pubid>
                  <pubid idtype="doi">10.1128/JB.183.23.6951-6956.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Survival and induction of recA protein in mitomycin C-treated Escherichia coli rec, lex, or uvr strains</p>
            </title>
            <aug>
               <au>
                  <snm>Giacomoni</snm>
                  <fnm>PU</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1983</pubdate>
            <volume>258</volume>
            <fpage>13653</fpage>
            <lpage>13657</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">6417132</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Construction and physiological analysis of a <it>Xanthomonas oryzae recA </it>mutant</p>
            </title>
            <aug>
               <au>
                  <snm>Mongkolsuk</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rabibhadana</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sukchavalit</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Vaughn</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>1998</pubdate>
            <volume>169</volume>
            <fpage>269</fpage>
            <lpage>275</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1574-6968.1998.tb13328.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9868770</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Structural characterization of the exocellular polysaccharide produced by <it>Streptococcus thermophilus </it>Sfi39 and Sfi12</p>
            </title>
            <aug>
               <au>
                  <snm>Lemoine</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chirat</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Wieruszelski</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Strecker</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Favre</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Neeser</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>1997</pubdate>
            <volume>63</volume>
            <fpage>3512</fpage>
            <lpage>3518</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">168657</pubid>
                  <pubid idtype="pmpid" link="fulltext">9293002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Molecular cloning. A laboratory manual</p>
            </title>
            <aug>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Maniatis</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <publisher>Cold Spring Harbor Laboratory Press</publisher>
            <edition>Second</edition>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Disruption of the gene encoding penicillin-binding protein 2b (<it>pbp2b</it>) cause altered cell morphology and cease in exopolysaccharide production in <it>Streptococcus thermophilus </it>Sfi6</p>
            </title>
            <aug>
               <au>
                  <snm>Stingele</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Mollet</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1996</pubdate>
            <volume>22</volume>
            <fpage>357</fpage>
            <lpage>366</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.1996.00121.x</pubid>
                  <pubid idtype="pmpid">8930919</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Proline biosynthesis in <it>Streptococcus thermophilus </it>: characterization of the <it>proBA </it>operon and its products</p>
            </title>
            <aug>
               <au>
                  <snm>Limauro</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Falciatore</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Basso</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Forlani</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>De Felice</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Microbiol</source>
            <pubdate>1996</pubdate>
            <volume>142</volume>
            <fpage>3275</fpage>
            <lpage>3282</lpage>
         </bibl>
         <bibl id="B27">
            <title>
               <p>The <it>lrp </it>Gene and Its Role in Type I Fimbration in <it>Citrobacter rodentium</it></p>
            </title>
            <aug>
               <au>
                  <snm>Cordone</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mauriello</snm>
                  <fnm>EMF</fnm>
               </au>
               <au>
                  <snm>Pickard</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Dougan</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>De Felice</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ricca</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2005</pubdate>
            <volume>187</volume>
            <fpage>7009</fpage>
            <lpage>7017</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1251604</pubid>
                  <pubid idtype="pmpid" link="fulltext">16199571</pubid>
                  <pubid idtype="doi">10.1128/JB.187.20.7009-7017.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
