The extracellular β-galactosidase of Aspergillus niger presents, along its primary structure, a lower number of charged amino acids (Figure 1) compared to the intracellular K. lactis β-galactosidase, showing the A. niger β-galactosidase a 50% reduction in histidine and 43% in lysine content. This difference in charged amino acids could facilitate the secretion of the A. niger β-galactosidase, since amino acid charge distribution plays an important role in the localization of secreted and membrane proteins 18.

The construction of hybrid enzymes can be performed by means of different procedures from which new variants are arising constantly 1920212223. In our experimental design, homologous recombination was discarded because the homology between genes was insufficient 2425. Therefore, the corresponding constructions were made by PCR amplification of the selected domains, restriction and ligation. Since previous work had demonstrated that, in K. lactis, mutant β-galactosidases with large deletions in the N-terminal region were inactive 3 we designed two hybrid proteins between K. lactis and A. niger β-galactosidases interchanging the C-terminal region. Constructions were made in the pSPGK1 plasmid 26 and were called pSPGK1-LAC4-LACA-BamHI and pSPGK1-LAC4-LACA-KpnI. Both contain in the N-terminus the secretory signal of the pre-sequence of the K. lactis killer toxin that has rendered good levels of secretion in other trials 3. In the first construction, the 500 N-terminal amino acids of the K. lactis β-galactosidase were fussed in frame to the 478 amino acids of the C-terminal side of the A. niger enzyme. In the second, only the segment corresponding to the fifth domain, 297 amino acids positioned at the C-terminus, of the K. lactis β-galactosidase was replaced by the corresponding fifth domain, 274 amino acids positioned at the C-terminus, of the A. niger enzyme. The prediction of domains in the proteins from K. lactis and A. niger (Figure 1) was done by multiple alignments and in comparison with the sequence and structure of the E. coli β-galactosidase experimentally determined by crystallography 27.

To examine the kinetics of β-galactosidase secretion, a K. lactis β-galactosidase mutant strain, MW190-9B, was transformed with the above described constructions and with the plasmid pSPGK1-LAC4, bearing the gene coding for K. lactis β-galactosidase, as a control. Discontinuous cultures were made in liquid medium in Erlenmeyer flasks.

The levels of extracellular and intracellular β-galactosidase produced were different in the three transformants (Figure 2). In all cases extracellular β-galactosidase activity was detected in the media. It is important to remark that values of secreted protein are underestimated in this work if compared to other data in the literature. Usually in the bibliography the term extracellular activity includes also the activity of the periplasmic enzyme that is not effectively released to the medium. We have preferred to use the term extracellular to design uniquely the enzyme available in the medium, out of the cell, because its biotechnological use is easier.

The strain transformed with the plasmid pSPGK1-LAC4-LACA-BamHI showed a lower intracellular and extracellular β-galactosidase production than the control. This result may be attributed to the fact that a portion of the catalytic site of the K. lactis β-galactosidase was replaced by the catalytic site of A. niger β-galactosidase. Nevertheless, MW190-9B transformed with pSPGK1-LAC4-LACA-KpnI showed the highest absolute values of intracellular and extracellular β-galactosidase production, almost three times and twice higher, respectively, than those obtained for MW190-9B transformed with pSPGK1-LAC4, although β-galactosidase activity into the culture medium reaches only 2.6% of the intracellular activity. In this case, the catalytic site from the K. lactis enzyme remained intact, since only the segment corresponding to the fifth domain was exchanged.

However, the growth rate of MW190-9B transformed with pSPGK1-LAC4-LACA-KpnI diminished to half of the reached by the strain transformed with pSPGK1-LAC4. Cellular lysis was discarded by measuring cellular viability (Figure 2), therefore this slow growth may be attributed to the fact that the cells direct the available energy towards β-galactosidase production rather than division.

Two conclusions are obtained from these results. First, the C-terminal region of A. niger β-galactosidase functionally complements the C-terminal region of K. lactis β-galactosidase. Similarly, the fifth domain of the E. coli β-galactosidase has been related to the ω-fragment and early studies have shown that it folds independently and complements molecules missing this part of the sequence (ω-complementation) 27. Second, the construction pSPGK1-LAC4-LACA-KpnI is of biotechnological value and therefore we decide to further characterize this hybrid protein.

Determination of optimum pH and temperature, thermal stability, effects produced by divalent cations upon enzymatic activity and calculation of kinetics constants was performed. To carry out these measures, crude extracts of the strain MW190-9B transformed with pSPGK1-LAC4-LACA-KpnI and with pSPGK1-LAC4 (control) were obtained at the moment of maximum expression of β-galactosidase activity (80 hours).

For the determination of the optimum pH, the measurements of enzymatic activity were carried out in buffer Z aliquots modified to obtain pH values from 5 up to 8.5. As seen in Figure 3A, the optimum pH for the β-galactosidase of K. lactis is about 7, whereas for the hybrid protein is slightly acid 6.5. The optimum pH values reported for β-galactosidases from A. niger are from 2.5 to 4 28 whereas from K. lactis are from 7 to 7.5 2930. Therefore, the constructed hybrid protein has characteristics with regard to the pH optimum that differs from its precursors. It was reported that, at pH 6.5, the activity of K. lactis β-galactosidase decreased significantly due to local changes in charged residues 30. The hybrid protein, with a different composition in charged amino acids, may buffer these local changes and therefore it may be more tolerant to pH changes during culture.

The optimum temperature reported for A. niger β-galactosidase is 50°C 31 whereas for K. lactis β-galactosidase is 30°C 29. For the determination of the optimum temperature of the hybrid protein and K. lactis control, the measurements of enzymatic activity were performed at different temperatures, from 15°C to 50°C (Figure 3B). It was observed that whereas in our conditions the optimum temperature for K. lactis β-galactosidase is around 35°C, in the hybrid protein is slightly greater, being near to 40°C. In the same way as for the optimum pH, the constructed hybrid protein presents characteristics that make it more adequate to high temperature during catalysis.

Thermal stability of the hybrid β-galactosidase was also determined and compared to the native β-galactosidase of K. lactis. Before performing the measurement of enzymatic activity, the enzymatic preparation was incubated in buffer Z at different times and temperatures: 30°C, 42°C, 50°C and 60°C. The hybrid β-galactosidase presented a higher stability than the one of K. lactis (Figure 4) at all tested temperatures. Almost the 75% of the enzyme kept stable after an hour of incubation at 30°C, the 60% after 15 minutes at 50°C, the 8% after 3 minutes at 60°C (data not show in Figure 4), clearly in advantage to the native K. lactis β-galactosidase stability (55%, 40% and 0% respectively). Although biotechnological applications may demand even higher thermal stability of the hybrid β-galactosidase, other procedures exist to improve this factor, i.e. immobilization as previously shown 32.

The activity of K. lactis β-galactosidase is stimulated by the presence of some divalent cations, Mg²⁺ or Mn²⁺, and inhibited by the presence of others, Ca²⁺, Zn²⁺ and Ni²⁺ 2933. The effect of Mg²⁺, Ca²⁺ and Zn²⁺on the activity of the hybrid protein and the native K. lactis β-galactosidase is similar (Figure 5A). Whereas the presence of Ca²⁺ or Zn²⁺ causes a slight inhibition of the activity, Mg²⁺ stimulates it clearly. Although an increase of the β-galactosidase activity has been described in presence of Mn²⁺ 29, this stimulatory effect could not be verified in this experiment due to the interference produced by reducing agents present in buffer Z (Figure 5B).

The cation Ni²⁺ exerts different effects in the activity of the native and hybrid proteins (Figure 5B). As previously described by other authors 33, the cation Ni²⁺ inhibits K. lactis β-galactosidase activity but over the hybrid enzyme the effect is activator. Crystallographic studies identified possible divalent cations binding sites in the structure of the E. coli β-galactosidase, although no functional significance was ascribed to them 34. Further studies to determine the relationship between structural features, cation binding and activity of β-galactosidase will be required.

The values of kinetic constants for the hybrid and native β-galactosidases were obtained from double-reciprocal plots (Figure 6). Hybrid β-galactosidase presents a greater affinity both for ONPG (K_m 0.8 mM) and lactose (K_m 8.7 mM) than K. lactis β-galactosidase (1.5 mM and 21 mM, respectively). This striking increase in affinity aimed us to look for a structural explanation of the change.

Three-dimensional protein structures are important for a detailed understanding of the molecular basis of protein function. In absence of direct experimental data, a computational approach by homology modelling is a reliably method to generate a three-dimensional model for a protein. In order to understand the differences between the hybrid and native K. lactis β-galactosidases, a prediction of the tertiary structure of these proteins and the A. niger β-galactosidase was made. The server for automated comparative modelling Swiss-Model 35 was used. The amino acids E461, M502, Y503 and E537, considered important residues for the catalytic activity of the E. coli β-galactosidase 2734 and which form the active-site pocket, are highly conserved in the K. lactis β-galactosidase (residues E482, M522, Y523 and E551) 36. As depicted in Figure 7A, a part of the active site is formed by a deep pit that intrudes well into the core of the TIM barrel at the third domain. In addition, there are loops coming from the first and fifth domain. In the case of the hybrid protein (Figure 7C), the fifth domain of the K. lactis β-galactosidase was replaced by the corresponding domain of the A. niger enzyme (Figure 7B). Structurally, as predicted by the model, this causes a slight opening of the third domain. This could favour the accessibility of the substrate and could explain the change in the kinetic constants.

The Kluyveromyces lactis MW 190-9B strain (MATa lac4-8 uraA Rag+) was used. Liquid batch cultures of transformed cells were grown in Erlenmeyer flasks filled with 20% volume of culture medium at 250 rpm, unless otherwise stated. As inocula, a suitable volume of a stationary phase culture in complete medium 37 without the amino acid corresponding to the strain auxotrophy, was added to obtain an initial OD₆₀₀ of 0.2. The same medium was also used as culture media. Samples were taken at regular time intervals to measure growth (OD₆₀₀), percentage of viable cells, intracellular and extracellular β-galactosidase activity.

The pSPGK1-LAC4 3, a derivative of pSPGK1 plasmid 26 containing the secretory signal that corresponds to the pre-sequence (16 amino acids) of the K. lactis killer toxin (α-subunit) and the PCR-amplified LAC4 gene (which codes for K. lactis β-galactosidase) inserted between the constitutive promoter and the terminator of the S. cerevisiae phosphoglycerate-kinase (PGK) gene, was used for building new vectors. Vectors were constructed as follows:

-pSPGK1-LAC4-LACA-BamHI: plasmid pSPGK1-LAC4 was digested with BamHI. The BamHI-BamHI fragment that contains the C-terminal segment of the K. lactis β-galactosidase was removed and replaced by the C-terminal segment of the Aspergillus niger β-galactosidase amplified from pVK1.1 16 with the following oligonucleotides creating BamHI sites on the ends of the PCR product: GAAGGATCCTGAGTCTGGCATCTCG, CCACACCCGTCCTGTGGATCC.

-pSPGK1-LAC4-LACA-KpnI: plasmid pSPGK1-LAC4 was digested with KpnI and ligated to the segment corresponding to the five domain of the A. niger β-galactosidase amplified from pVK1.1 with the following oligonucleotides generating KpnI sites on the ends of the PCR product: GCGGTACCCCGCGGACACTTCACCGC, GCGGTACCGCCATCTCCTTGCATGC.

A 20 ng amount of template DNA was incubated with 30 pmol of primer-1 and 30 pmol of primer-2 in the presence of 0.25 mM dNTPs, Taq or Pwo polymerase buffer and 2 U of the corresponding polymerase. Initial denaturation was done at 94°C for 2 min, followed by 30 cycles of 1 min at 95°C, 2 min at 50–57°C and 1.5–2.5 min at 72°C. There was a final incubation at 72°C for 10 min to fill-in ends.

Escherichia coli DH5a strain (supE44 DlacU169 f80lacZDM15 hsdR17 recA1 endA1 gyrA96 thi-1 relA1) was used for the construction of the plasmids and propagation by means of the usual DNA recombinant techniques according to Ausubel et al. 38. Yeast strains were transformed using the lithium acetate procedure 39. Plasmid uptake and β-galactosidase production by the transformed strains were identified on plates with the chromogenic substrate X-gal in the corresponding auxotrophic medium.

The methylene blue solution, which contained 0.01% Methylene Blue (Sigma-Aldrich, M9140) and 2% (w/v) tri-sodium citrate dihydrate in phosphate-buffered saline solution (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄ and 1.8 mM KH₂PO₄, pH 7.4), was mixed with an equal volume of yeast suspension for 10 min. Unstained cells were assumed to be viable. The stained cells in the mixture were quantified under an optical microscope (Nikon Eclipse 50i). The viability of 100 cells, from five replicates of each sample, was assessed and expressed as the mean percentage of viable cells.

The method of Guarente 40 as previously described 3 was used. One enzyme unit (E. U) was defined as the quantity of enzyme that catalyzes the liberation of 1 μmol of ortho-nitrophenol from ortho-nitrophenyl-β-D-galactopyranoside per min under assay conditions. E.U. are expressed per mL of culture medium.

Throughout this paper and unless otherwise specified, the term extracellular β-galactosidase is used to mean the enzyme in the culture medium and the term intracellular β-galactosidase is used to mean the cell-associated enzyme, both periplasmic and cytoplasmic.

For the preparation of crude protein extracts, the cells were harvested by centrifugation at 7000 rpm for 5 min at 4°C and washed once with distilled water. They were suspended in 20 mM Tris-HCl, pH 7.8, 300 mM (NH₄)₂SO₄, 10 mM MgCl₂, 1 mM EDTA, 10% glycerol buffer with 0.1 mM PMSF, 4 mM Pepstatin, 4 mM Leupeptin and 2 μM β-mercaptoethanol and broken using a sonicator at 16 μm for a total of 20 min at 4°C making four exposures of 5 min, with 5 min intervals after each. Cell debris was removed by centrifugation at 40000 rpm for 90 min at 4°C. The supernatant constituted the cell-free extract.

Protein was determined by the method of Bradford 41 using bovine serum albumin (Sigma) as a standard.

The characterization was carried out from a crude extract of the strain of K. lactis MW190-9B/pSPGK1-LAC4-LACA-KpnI obtained at the moment of maximum expression of β-galactosidase activity (80 hours). As a control, in all the essays performed, the same quantity of protein of a crude extract of the strain of K. lactis MW190-9B/pSPGK1-LAC4, obtained at the moment of maximum expression of β-galactosidase activity, was taken.

In order to calculate the optimum pH, 60 μg of the crude yeast protein extract were incubated in buffer Z (100 mM Na₂HPO₄, 40 mM NaH₂PO₄, 10 mM KCl, 1.6 mM MgSO₄ and 2.7 mL of β-mercaptoethanol for litre of dissolution) adjusted respectively to pH 5; 5.5; 6; 6.5; 7; 7.5 and 8.

For optimum temperature determination, the enzymatic activity of 60 μg of the crude protein extract was measured at different temperatures: 15, 20, 25, 30, 35, 40, 45 and 50°C.

In thermal stability experiments, 30 μg of the yeast crude protein extract were incubated during different periods of time to different temperatures: 30, 42, 50 and 60°C.

For the determination of the effects of divalent cations on the enzymatic activity, 100 μg of the crude protein extract and several increasing concentrations (0.1, 0.5, 1.5 and 10 mM) of CaCl₂, MgCl₂, MnCl₂, ZnSO₄ or NiCl₂ were added to the buffer Z and the enzymatic activity was measured as previously described.

The β-galactosidase activity was tested with the artificial substratum ONPG and the natural substratum lactose. The determination of the β-galactosidase activity in 30 μg of the crude extract was made as above explained, but in presence of different concentrations of ONPG: 2, 3, 6, 8 and 12 mM. Alternatively, 60 μg of the crude extract were incubated with different concentrations of lactose: 5, 20, 40, 80 and 160 mM. To determine lactose hydrolysis, a commercial kit was used (Boehringer-Mannheim) following the supplier instructions. The method is based on the oxidation of the product D-galactose by the β-galactose dehydrogenase. The amount of NADH formed in this last reaction is stoichiometric to the amount of lactose and D-galactose. The NADH production was measured following the absorbance increase at 340 nm.

The models of the K. lactis and A. niger β-galactosidases and the hybrid protein were made with the fully automated protein structure homology-modelling server Swiss-Model 35.